View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20070_low_19 (Length: 361)
Name: NF20070_low_19
Description: NF20070
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20070_low_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 212; Significance: 1e-116; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 19 - 242
Target Start/End: Original strand, 45540245 - 45540468
Alignment:
| Q |
19 |
gatttacgaactggtcatgctacaaatgcttatcaaccaccacctccgttaacagaacaagagcttgggagagcatctaacaatcctttggaagctcatt |
118 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45540245 |
gatttacgaactggtcatgccacaaatgcttatcaaccaccacctccgttaacagaacaagagcttgggagagcatctaacaatcctttggaagctcatt |
45540344 |
T |
 |
| Q |
119 |
ctcatataccagacatcaaccaagcctccgtgacatcattgtcgtcatcgttccaaaatccattcctaggaccaagtgaggcaaccaacgacactgttga |
218 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
45540345 |
ctcatataccagacatcaaccaagcccccgtgacatcattgtcgtcatcgttccaaaatccattcataggaccaagtgaggcaaccaacgacactgttga |
45540444 |
T |
 |
| Q |
219 |
ggatgacacaaacattggtagttc |
242 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
45540445 |
ggatgacacaaacattggtagttc |
45540468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 106; E-Value: 6e-53
Query Start/End: Original strand, 240 - 353
Target Start/End: Original strand, 45540505 - 45540618
Alignment:
| Q |
240 |
ttcttcaactaatgttatttcaaatctcaattcaccaacatccacatatgaattgtcgcaagagagttcattcaatgagaaaacaaatacaaataacagt |
339 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
45540505 |
ttcttcaactaatgttatttcaaatctcaattcaccaacatccacatatgaattgtcgcaagaaagttcattcaatgagaaaacaaatacaaataacagt |
45540604 |
T |
 |
| Q |
340 |
gactctgatgatgt |
353 |
Q |
| |
|
||||| |||||||| |
|
|
| T |
45540605 |
gactccgatgatgt |
45540618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University