View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20070_low_22 (Length: 335)

Name: NF20070_low_22
Description: NF20070
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20070_low_22
NF20070_low_22
[»] chr2 (2 HSPs)
chr2 (1-103)||(8923972-8924075)
chr2 (281-319)||(8924277-8924315)


Alignment Details
Target: chr2 (Bit Score: 71; Significance: 4e-32; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 1 - 103
Target Start/End: Original strand, 8923972 - 8924075
Alignment:
1 tcaaagacaaagattatgacattatatttttt-acttcattatcctattataannnnnnnatgaccgaaagttttaagtgagttgcaaggccgcaaatag 99  Q
    |||||||||||||||||||||||||||||||| | ||||||||||||||||||       ||||||||||||||||||||||||||||||||||||||||    
8923972 tcaaagacaaagattatgacattatatttttttatttcattatcctattataatttttttatgaccgaaagttttaagtgagttgcaaggccgcaaatag 8924071  T
100 taag 103  Q
    ||||    
8924072 taag 8924075  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 281 - 319
Target Start/End: Original strand, 8924277 - 8924315
Alignment:
281 ggtggtagccacctgtgactgtggagttgggtgattttg 319  Q
    |||||||||||||||||||||||||||||||||||||||    
8924277 ggtggtagccacctgtgactgtggagttgggtgattttg 8924315  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University