View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20071_high_42 (Length: 325)
Name: NF20071_high_42
Description: NF20071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20071_high_42 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 128; Significance: 4e-66; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 128; E-Value: 4e-66
Query Start/End: Original strand, 23 - 186
Target Start/End: Complemental strand, 370136 - 369972
Alignment:
| Q |
23 |
catgctttcaaggaaaatatatcagcccccttgctgagaagtgagaacaaatgactnnnnnnn-tcaataatgaacttttctggataatttgtttaactt |
121 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||| |
|
|
| T |
370136 |
catgctttcaaggaaaatatagcagcccccttgctgagaagtgagaacaaatgactaataaaaatcaataatgaacttttttggataatttgtttaactt |
370037 |
T |
 |
| Q |
122 |
ttttcttggtccaacggtgtaatcttgatatagtttacacatgtatttgaactaacatgaaactt |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
370036 |
ttttcttggtccaacggtgtaatcttgatatagtttacacatgtatttgaactaacatgaaactt |
369972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 232 - 325
Target Start/End: Complemental strand, 369960 - 369867
Alignment:
| Q |
232 |
atttcaaagctgctgctgacttgatatgttaagaaacataagtgaatcagtacagcatttttctcactgaaacctgatatcaaagtttctaaat |
325 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
369960 |
atttcaaagctgctgctgacttgatatgttaagaaacataagtgaatcagtatagcatttttctcactgaaacctgagatcaaagtttctaaat |
369867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University