View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20071_high_58 (Length: 250)
Name: NF20071_high_58
Description: NF20071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20071_high_58 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 61 - 250
Target Start/End: Complemental strand, 53474847 - 53474659
Alignment:
| Q |
61 |
aaactgaataagttagacgacataatctgctcccacccaaacacgataaagaccttatacaacaacacttgaagcaataactcacatgttactaagagat |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53474847 |
aaactgaataagttagacgacataatctgctcccacccaaacacgataaagaccttatacaacaacacttgaagcaataactcacatgttactaagagat |
53474748 |
T |
 |
| Q |
161 |
ggctacaaaggaagcaatttgcatgatcaacctcgacgacaaaggaaaggttgttaccttttaatgttagagttcgatagcttttccatc |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
53474747 |
ggctacaaaggaagcaatttgcatgatcaacctcgacgacaaaggaaaggctgttacc-tttaatgttagagttcgatagcttttccatc |
53474659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University