View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20071_low_22 (Length: 441)
Name: NF20071_low_22
Description: NF20071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20071_low_22 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 257; Significance: 1e-143; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 18 - 290
Target Start/End: Original strand, 43208614 - 43208886
Alignment:
| Q |
18 |
attaggacatgaaaatatcatatgcatgtagaggataggatttgtctcttaatataccttttattatcttcatggacagtgtcattgctcgaattcaacc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
43208614 |
attaggacatgaaaatatcatatgcatgtagaggataggatttgtctcttaatataccttttattatcttcatggacagtgtcattgctcaaattcaacc |
43208713 |
T |
 |
| Q |
118 |
tttctgatgcccacgagttttgggatgggtgacttctaaattctaatcagtcaggtatagcatttggcactcatcaatcttgctctttatttgccagcca |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43208714 |
tttctgatgcccacgagttttgggatgggtgacttctaaattctaatcagttaggtatagcatttggcactcatcaatcttgctctttatttgccagcca |
43208813 |
T |
 |
| Q |
218 |
tttgaattctgctttgtgatatgtctgcgtgttttgttctgtttgtgttgttgtcttagtgatagattatgac |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
43208814 |
tttgaattctgctttgtgatatgtctgcgtgttttgttctgtttgtgttgctgtctgagtgatagattatgac |
43208886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 181; E-Value: 1e-97
Query Start/End: Original strand, 34 - 290
Target Start/End: Original strand, 43188279 - 43188535
Alignment:
| Q |
34 |
atcatatgcatgtagaggataggatttgtctcttaatataccttttattatcttcatggacagtgtcattgctcgaattcaacctttctgatgcccacga |
133 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||| | |
|
|
| T |
43188279 |
atcatatgcatgtagaggataggatttgtctcttaatatgccttttattatcttcatggacagtttcattgctcgaattcaacctttctgatgcccgcat |
43188378 |
T |
 |
| Q |
134 |
gttttgggatgggtgacttctaaattctaatcagtcaggtatagcatttggcactcatcaatcttgctctttatttgccagccatttgaattctgctttg |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||| ||||||||| | |||||||||||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
43188379 |
gttttgggatgggtgacttctaaattctaatcagctaggtgtagcatttgcccctcatcaatcttgctctttatttgccggccatttgaattcaactttg |
43188478 |
T |
 |
| Q |
234 |
tgatatgtctgcgtgttttgttctgtttgtgttgttgtcttagtgatagattatgac |
290 |
Q |
| |
|
||||| |||| ||||||||||||||||||||||||||||| || |||||| ||||| |
|
|
| T |
43188479 |
tgatacttctgtgtgttttgttctgtttgtgttgttgtcttggttatagatgatgac |
43188535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 355 - 431
Target Start/End: Original strand, 43208951 - 43209027
Alignment:
| Q |
355 |
ccctttctaatcgaccgtgattggtgccgttgaccttctaataaatgtttcaaggtatcccacaatttagccctttg |
431 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43208951 |
ccctttctaatcgaccgtgattggtgccgttgaccttctaataaatgtttcaaggtatcccacaatttagccctttg |
43209027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 355 - 405
Target Start/End: Original strand, 43188600 - 43188650
Alignment:
| Q |
355 |
ccctttctaatcgaccgtgattggtgccgttgaccttctaataaatgtttc |
405 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||||| |||||| ||||||| |
|
|
| T |
43188600 |
ccctttctaatcgatcgtgattggtgttgttgacctcctaatagatgtttc |
43188650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University