View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20071_low_23 (Length: 436)
Name: NF20071_low_23
Description: NF20071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20071_low_23 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 202; Significance: 1e-110; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 205 - 430
Target Start/End: Complemental strand, 38516371 - 38516147
Alignment:
| Q |
205 |
gattatgattattttggaagagatgaaagaaacgcgtttgttaaataggagaattggaaatgatgaaaataagggttttgatggcgggaataagcaagct |
304 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
38516371 |
gattatgattattttggaagagatgaaagaaacgcgtttgttaaataggagaattggaaatgatgaaaagaagggttt-gatggcgggaataagcaagct |
38516273 |
T |
 |
| Q |
305 |
gtttggcgggataagttgccgcttggaactgctgtgaaaattttgtagcttttttggtttcggcttgggtttttattaaattgattacgggttatatgag |
404 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38516272 |
gtttggcgggataagttgccgcttggaactgctgtgaaaattttgtagcttttttggtttgggcttgggtttttattaaattgattacgggttatatgag |
38516173 |
T |
 |
| Q |
405 |
ggttagctacacactacctttgctac |
430 |
Q |
| |
|
|||||||||||||||| |||||||| |
|
|
| T |
38516172 |
tgttagctacacactacttttgctac |
38516147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 18 - 155
Target Start/End: Complemental strand, 38516553 - 38516416
Alignment:
| Q |
18 |
ataagcgggcctgtgacggagatagggggatctacacgatcggagccgtctggggagacgtagatgcgtggacggggtaggcttgaaccgtagaatttgg |
117 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38516553 |
ataagcgggccggtgacggagatagggggatctacacgatcggagccgtctggggagacgtagatgcgtggacggggtaggcttgaaccgtagaatttgg |
38516454 |
T |
 |
| Q |
118 |
atggttttagagaaacaaccattttggaagcgattttg |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38516453 |
atggttttagagaaacaaccattttggaagcgattttg |
38516416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University