View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20071_low_39 (Length: 353)
Name: NF20071_low_39
Description: NF20071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20071_low_39 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 302; Significance: 1e-170; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 19 - 344
Target Start/End: Complemental strand, 36521902 - 36521577
Alignment:
| Q |
19 |
gtagctaccaataaagattgcacacgggaccgagttgagactactaggtcaattgttgaaggaaaatgaagatttgatgttttcttgtattagatcattg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36521902 |
gtagctaccaataaagattgcacacgggaccgagttgagactactaggtcaattgttgaaggaaaatgaagatttgatgttttcttgtattagatcattg |
36521803 |
T |
 |
| Q |
119 |
gttttgcatttaattattgatatgtatttatgagatgttcattccatttgaattagattatcttcatataatacctcttattatttaaatctttataaat |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36521802 |
gttttgcatttaattattgatatgtatttatgagatgttcattccatttgaattagattatcttcatataatacctcttattatttaaatctttataaat |
36521703 |
T |
 |
| Q |
219 |
tcagagacaattttgagttgagannnnnnnnatatacaatgacttgcgtctttcaaatgaatgcagctttatctcattcctgtcaaatttttataagacc |
318 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36521702 |
tcagagacaattttgagttgagattttttttatatacaatgacttgcgtctttcaaatgaatgcagctttatctcattcctgtcaaatttttataagacc |
36521603 |
T |
 |
| Q |
319 |
aacaatatgttattatggagtataat |
344 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
36521602 |
aacaatatgttattatggagtataat |
36521577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University