View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20071_low_49 (Length: 304)
Name: NF20071_low_49
Description: NF20071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20071_low_49 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 19 - 293
Target Start/End: Complemental strand, 14266483 - 14266209
Alignment:
| Q |
19 |
ggaccgtcatggtgtcattaggaatgaacgttgccgtaagatttgcttctgcattatataaaagattcatctgannnnnnnnnctaaaccatgcttatgt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
14266483 |
ggaccgtcatggtgtcattaggaatgaacgttgccgtaaggtttgcttctgcattatataaaagattcatctgaaatttttt-ctaaaccatgcttatgt |
14266385 |
T |
 |
| Q |
119 |
taaatgttaaattcgatggattaaatttt-gcagtgtgagagtttcaaatgaactaggagcagttcacccaagaacagcaagattttcattggtggtagc |
217 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14266384 |
taaatgttaaattcgatggattaaatttttgcagtgtgagagtttcaaatgaactaggagcagttcacccaagaacagcaagattttcattggtggtagc |
14266285 |
T |
 |
| Q |
218 |
cgtgattacgtcaattttaatcggattattattggctcttgttttgattatctcacgagacaagtaccctgcctat |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14266284 |
cgtgattacgtcaattttaatcggattattattggctcttgttttgattatctcacgagacaagtaccctgcctat |
14266209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University