View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20071_low_57 (Length: 267)
Name: NF20071_low_57
Description: NF20071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20071_low_57 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 20 - 257
Target Start/End: Complemental strand, 22703896 - 22703659
Alignment:
| Q |
20 |
actacttcaccatttcatgtatgaccctgcagcgtgtgttctgcagtattagttataattttaaggtcattcaaatttgtgaaaatataatattttaaat |
119 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22703896 |
actacttcaccatttcatgtatggccctgcagcgtgtgttctgcagtattagttataattttaaggtcattcaaatttgtgaaaatataatattttaaat |
22703797 |
T |
|
| Q |
120 |
gaatattgtgtgttttagaagattttcaataaggagtggtgccctaataccgccgtttcaattccatctttatcggttgagtaatcataaactttcctag |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22703796 |
gaatattgtgtgttttagaagattttcaataaggagtggtgccctaataccgccgtttcaattccatctttatcggttgagtaatcataaactttcctag |
22703697 |
T |
|
| Q |
220 |
cttgtttctgcaccaccgtttctaaactaaaacctttg |
257 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
22703696 |
cttgtttctgcaccaccgtttctaaacaaaaacctttg |
22703659 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 155 - 211
Target Start/End: Complemental strand, 54221382 - 54221327
Alignment:
| Q |
155 |
gtggtgccctaataccgccgtttcaattccatctttatcggttgagtaatcataaac |
211 |
Q |
| |
|
|||||||||||||||||||||||||| | ||| |||||| ||||||| ||||||||| |
|
|
| T |
54221382 |
gtggtgccctaataccgccgtttcaaatgcat-tttatcagttgagttatcataaac |
54221327 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University