View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20071_low_60 (Length: 257)
Name: NF20071_low_60
Description: NF20071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20071_low_60 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 124; Significance: 7e-64; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 124; E-Value: 7e-64
Query Start/End: Original strand, 10 - 152
Target Start/End: Complemental strand, 37728506 - 37728366
Alignment:
| Q |
10 |
gcagagacgggattgcgaaacacctcttagccaattaaattctctcctagccgggattgttgttgctatattaattgaatggagcggttagtcaaagaat |
109 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37728506 |
gcagtgacgggattgcgaaacacctcttagccaattaaattgtc--ctagccgggattgttgttgctatattaattgaatggagcggttagtcaaagaat |
37728409 |
T |
 |
| Q |
110 |
taagttaaatcaaatggataaaatcttgctagtcaatatgact |
152 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37728408 |
taagttaaatcaaatggataaaatcttgctagtcaatatgact |
37728366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 191 - 241
Target Start/End: Complemental strand, 37728347 - 37728293
Alignment:
| Q |
191 |
gagaagtcattcaagaaagagaaaagagg----cgtgctagccaaagggagatgt |
241 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
37728347 |
gagaagtcattcaagaaagagaaaagaggcgtacgtgctagccaaagggagatgt |
37728293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University