View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20071_low_62 (Length: 250)
Name: NF20071_low_62
Description: NF20071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20071_low_62 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 26 - 232
Target Start/End: Complemental strand, 37592517 - 37592311
Alignment:
| Q |
26 |
tagcagcattcattgcagtgtttccaatatatagacactgtcactatcataatcatcaatactactaactaacaaggacctaaaattgtactacgcacac |
125 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
37592517 |
tagcagcattcattgcagtgtttccaatatatagacactgtcactatcataatcatcaatactactaactaacaaggacctaaaattgtactacgcaaac |
37592418 |
T |
|
| Q |
126 |
agataggaacgaaaatggaaatcaaagaggaaatggaggatggtaagcagaaaggaatgagagaagcattgataggggaacacaacaaccaacttgtcca |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
37592417 |
agataggaacgaaaatggaaatcaaagaggaaatggaggatggtaagcagaaaggaatgagagaaccattgataggggaacacaacaaccaacttgtcca |
37592318 |
T |
|
| Q |
226 |
tgcaaac |
232 |
Q |
| |
|
||||||| |
|
|
| T |
37592317 |
tgcaaac |
37592311 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 140 - 232
Target Start/End: Original strand, 37461886 - 37461978
Alignment:
| Q |
140 |
atggaaatcaaagaggaaatggaggatggtaagcagaaaggaatgagagaagcattgataggggaacacaacaaccaacttgtccatgcaaac |
232 |
Q |
| |
|
||||| ||||||||||| |||| | ||| || ||||||||||| |||||| |||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
37461886 |
atggatatcaaagaggatgtggaaggtggcaaacagaaaggaataagagaaccattgataggtgaacaaaacaaccaacttgtccatgcaaac |
37461978 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University