View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20071_low_64 (Length: 248)
Name: NF20071_low_64
Description: NF20071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20071_low_64 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 37239553 - 37239779
Alignment:
| Q |
1 |
aattttgagtttaatattagtacaaaaagtacaacaaaaattcagtgattcattcacatctcacaatacatatgtcactttgttatattataaaatggga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37239553 |
aattttgagtttaatattagtacaaaaagtacaacaaaaattcagtgattcattcacatttcacaatacatatgtcactttgttatattataaaatggga |
37239652 |
T |
|
| Q |
101 |
tatgactagatgattgtacaannnnnnnnnataacaaatgatatttgtataacccttttagtatgtccatggattataaactatcttcaactttcttaat |
200 |
Q |
| |
|
|||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37239653 |
tatgaccagatgattgtacaa-ttttttttataacaaatgatatttgtataacccttttagtatgtccatggattataaactatcttcaactttcttaat |
37239751 |
T |
|
| Q |
201 |
tgtagaaaacatgtttgtttattagctg |
228 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
37239752 |
tgtagaaaacatgtttgtttattagctg |
37239779 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University