View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20071_low_68 (Length: 246)
Name: NF20071_low_68
Description: NF20071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20071_low_68 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 67; Significance: 7e-30; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 115 - 185
Target Start/End: Complemental strand, 26452822 - 26452752
Alignment:
| Q |
115 |
tgcaaagcaaggtccgcgatctatataattcaattattacttcgggaattccaaatcacaagttgagatta |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
26452822 |
tgcaaagcaaggtccgcgatctatataattcaattattacttccggaattccaaatcacaagttgagatta |
26452752 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University