View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20071_low_72 (Length: 239)
Name: NF20071_low_72
Description: NF20071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20071_low_72 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 67; Significance: 7e-30; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 75 - 153
Target Start/End: Original strand, 3225991 - 3226069
Alignment:
| Q |
75 |
aagatattacaattttcacttctttacacttttatcccttctatagttatatattgtttactttgtcataattttataa |
153 |
Q |
| |
|
||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
3225991 |
aagatattacaattttcacttatttacagttttatcccttctatagttatatattgtttactttgtcgtaattttataa |
3226069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 2 - 48
Target Start/End: Original strand, 3225862 - 3225908
Alignment:
| Q |
2 |
attggatgtttatttataaaatgactaatttgtaaacgtgagactca |
48 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3225862 |
attggatgtttatttataaaatgactaatttgtaaacgtgagactca |
3225908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University