View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20071_low_77 (Length: 236)
Name: NF20071_low_77
Description: NF20071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20071_low_77 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 25322548 - 25322323
Alignment:
| Q |
1 |
tagattgaggatgatgccaaatacacctggctcaaacataagaaatatttcatatgagtttaaatatacgcnnnnnnnnnnn------ttacttgtatct |
94 |
Q |
| |
|
||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
25322548 |
tagattgag-atgatgccaaatacacctggctaaaacataagaaatatttcatatgagtttaaatatacgcaaaaaaaaaaaaaaaaattacttgtatct |
25322450 |
T |
 |
| Q |
95 |
gatctacattcgatcagatacatttcttttcnnnnnnngctttatttaagtttggaacgtaatctttattgtgattaatgtaagtatatgattgtaggaa |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25322449 |
gatctacattcgatcagatacatttcttttctttttttgctttatttaagtttggaacgtaatctttattgtgattaatgtaagtatatgattgtaggaa |
25322350 |
T |
 |
| Q |
195 |
agatttcactgcatatgttgatgtgtg |
221 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
25322349 |
agatttcactgcatatgttgatgtgtg |
25322323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University