View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20071_low_78 (Length: 235)

Name: NF20071_low_78
Description: NF20071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20071_low_78
NF20071_low_78
[»] chr4 (1 HSPs)
chr4 (1-222)||(53474308-53474529)


Alignment Details
Target: chr4 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 53474529 - 53474308
Alignment:
1 cctagaaattgtccttcccagacaaaaagaggttttcttcatgtaatcaaccaaattcagttctcaccttctaaccaacctgaaagatgatgatttgaga 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
53474529 cctagaaattgtccttcccagacaaaaagaggttttcttcatgtaatcaaccaaattcagttctcaccttctaaccaacctgaaagattatgatttgaga 53474430  T
101 agttttgtgacaaattttctctgggtttttcttttcacaatccccaaaatagatttagttgtaaaataaatagtagtagtaaaaatgaatgtgcaaaaat 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
53474429 agttttgtgacaaattttctctgggtttttcttttcacaatccccaaaatagatttagttgtaaaataaatagtagtagtaaaaatgaatgtgcaaaaaa 53474330  T
201 tcattattttatgattattatt 222  Q
    ||||||||||||||||||||||    
53474329 tcattattttatgattattatt 53474308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University