View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20072_high_29 (Length: 320)
Name: NF20072_high_29
Description: NF20072
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20072_high_29 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 193; Significance: 1e-105; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 121 - 313
Target Start/End: Complemental strand, 36727073 - 36726881
Alignment:
| Q |
121 |
aagaaataatacatagataagttatcagcttattgatttatgctcagaataatgcatagcacaagattttcccaatagggttgacggcacatatatagtg |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36727073 |
aagaaataatacatagataagttatcagcttattgatttatgctcagaataatgcatagcacaagattttcccaatagggttgacggcacatatatagtg |
36726974 |
T |
|
| Q |
221 |
attccatatcttctttatgtctttttcttctcatttgtggtgttttatatctttttcgtgtttcctacccttctttgcatcgtcttcttctct |
313 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36726973 |
attccatatcttctttatgtctttttcttctcatttgtggtgttttatatctttttcgtgtttcctacccttctttgcatcgtcttcttctct |
36726881 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 84; E-Value: 7e-40
Query Start/End: Original strand, 20 - 103
Target Start/End: Complemental strand, 36727180 - 36727097
Alignment:
| Q |
20 |
aatgatgccactgaactgactgaaggcaaaatgttaagcttttatttattttgaaaaagctaaatgaatattattaactaactc |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36727180 |
aatgatgccactgaactgactgaaggcaaaatgttaagcttttatttattttgaaaaagctaaatgaatattattaactaactc |
36727097 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University