View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20072_high_35 (Length: 264)
Name: NF20072_high_35
Description: NF20072
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20072_high_35 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 127; Significance: 1e-65; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 11 - 141
Target Start/End: Complemental strand, 49127553 - 49127423
Alignment:
| Q |
11 |
gaagaatatgtagtatttcttgttttcaaattattgtgtaggaaatagtgaaaataaatgtcattttcatcatttcctatacgaaaattcgagaacaagt |
110 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49127553 |
gaagaaaatgtagtatttcttgttttcaaattattgtgtaggaaatagtgaaaataaatgtcattttcatcatttcctatacgaaaattcgagaacaagt |
49127454 |
T |
 |
| Q |
111 |
aaagtgaaaacaatgtggtatttttatgatt |
141 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
49127453 |
aaagtgaaaacaatgtggtatttttatgatt |
49127423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 199 - 246
Target Start/End: Complemental strand, 49127365 - 49127318
Alignment:
| Q |
199 |
tgttatggatacagtcttcaaaaaagcgtcgaatttccatgatgcgat |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49127365 |
tgttatggatacagtcttcaaaaaagcgtcgaatttccatgatgcgat |
49127318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University