View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20072_high_38 (Length: 258)
Name: NF20072_high_38
Description: NF20072
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20072_high_38 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 56 - 249
Target Start/End: Original strand, 11036042 - 11036235
Alignment:
| Q |
56 |
aagaaattgcatttgagaacataattgtaaaatattgccccgtctatccttaaatctccgtagaatagatacctcaaaagcattgtcaatagtcataata |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
11036042 |
aagaaattgcatttgagaacataattgtaaaatattgccccgtctatccttaaatctccgtagaatagatacatcaaaagcattgtcaatagtcataata |
11036141 |
T |
 |
| Q |
156 |
gcatatgttaactctgtttcgatagtcataatagtagnnnnnnnnctttcaatagtcatatggacaaatgaataatttaagattgtagaataat |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
11036142 |
gcatatgttaactctgtttcgatagtcataatagtagttttttttctttcaatagtcatatggacaaacgaataatttaagattgtagaataat |
11036235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University