View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20072_high_40 (Length: 239)

Name: NF20072_high_40
Description: NF20072
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20072_high_40
NF20072_high_40
[»] chr8 (1 HSPs)
chr8 (63-153)||(40407598-40407688)


Alignment Details
Target: chr8 (Bit Score: 83; Significance: 2e-39; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 63 - 153
Target Start/End: Original strand, 40407598 - 40407688
Alignment:
63 gcttgatcaaccttttatgtatgtgttgttaatttgttttgtgcttttaatcaaatgtcgcgttctgatgtagagacgaaaattatggatg 153  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
40407598 gcttgatcaaccttttatgtatgtgttgttaattcgttttgtgcttttaattaaatgtcgcgttctgatgtagagacgaaaattatggatg 40407688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University