View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20072_high_46 (Length: 214)

Name: NF20072_high_46
Description: NF20072
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20072_high_46
NF20072_high_46
[»] chr5 (1 HSPs)
chr5 (25-203)||(14731251-14731429)


Alignment Details
Target: chr5 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 25 - 203
Target Start/End: Complemental strand, 14731429 - 14731251
Alignment:
25 taatttgcttaaaatgaattttgatgcattgtggatataaaaaattgtcaatgaatcataaatcatttgtgaagtttaatgtagtgatatcaacatgaat 124  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14731429 taatttgcttaaaatgaattttgatgcattgtggatataaaaaattgtcaatgaatcataaatcatttgtgaagtttaatgtagtgatatcaacatgaat 14731330  T
125 acaaaaccatagaaacttgaatataaatgtcaatttcatcttcaataatgaaatatggatttattgttgtttccatatt 203  Q
    |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
14731329 acaaaaccatagaaacttgaatataaatgtcaatgtcatcttcaataatgaaatatggatttattgttgtttccatatt 14731251  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University