View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20072_high_46 (Length: 214)
Name: NF20072_high_46
Description: NF20072
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20072_high_46 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 25 - 203
Target Start/End: Complemental strand, 14731429 - 14731251
Alignment:
| Q |
25 |
taatttgcttaaaatgaattttgatgcattgtggatataaaaaattgtcaatgaatcataaatcatttgtgaagtttaatgtagtgatatcaacatgaat |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14731429 |
taatttgcttaaaatgaattttgatgcattgtggatataaaaaattgtcaatgaatcataaatcatttgtgaagtttaatgtagtgatatcaacatgaat |
14731330 |
T |
 |
| Q |
125 |
acaaaaccatagaaacttgaatataaatgtcaatttcatcttcaataatgaaatatggatttattgttgtttccatatt |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14731329 |
acaaaaccatagaaacttgaatataaatgtcaatgtcatcttcaataatgaaatatggatttattgttgtttccatatt |
14731251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University