View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
	Query
	Query hiting target	Query hiting target's complemental strand
	Query's complemental strand hiting target	Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20072_low_22 (Length: 398)

Name: NF20072_low_22

Description: NF20072

Algorithm: BLASTN 2.2.26 [Sep-21-2011]

Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF20072_low_22

[»] chr4 (1 HSPs)

[»] chr7 (1 HSPs)

Target: chr4 (Bit Score: 120; Significance: 3e-61; HSPs: 1)

Name: chr4

Description:

Target: chr4; HSP #1

Raw Score: 120; E-Value: 3e-61

Query Start/End: Original strand, 157 - 308

Target Start/End: Complemental strand, 37750281 - 37750130

Alignment:

Q	157	aatgagcatgaagtaaaactgttacaagtggaatctcttcactcttggtgttccttaaaacttttcttgtagcagataatgaacttgagaaaatttctgt	256	Q
		\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|
T	37750281	aatgagcgtgaagtaaaactgttacaagtggaatctcttcaatcttggtgttgcttaaaacttttcttgtgacagataatgaacttgagaaaatttctgt	37750182	T

Q	257	caatatgtttgtacaaaatacaatgggtaaaatttctcttatggagtgaggt	308	Q
		\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|
T	37750181	caatatgtttgttaaaaatacaatggttaaaatttctcttatggagtgaggt	37750130	T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 32; Significance: 0.000000009; HSPs: 1)

Name: chr7

Description:

Target: chr7; HSP #1

Raw Score: 32; E-Value: 0.000000009

Query Start/End: Original strand, 317 - 392

Target Start/End: Complemental strand, 40482834 - 40482759

Alignment:

Q	317	agcagagagggagcatggaaagtaaaagaaagtaatataggagcattattgtgcagcgaagttaccaaagataact	392	Q
		\|\|\|\|\|\|\|\|\| \|\| \|\|\|\| \|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\| \|\|\| \|\|\|\|\|\|\| \| \|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|
T	40482834	agcagagagtgaacatgtaaagaaaaagaaagtaaaataggataattcttgtgcaactaagttacaaaagataact	40482759	T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]