View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20072_low_24 (Length: 362)
Name: NF20072_low_24
Description: NF20072
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20072_low_24 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 212; Significance: 1e-116; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 37 - 297
Target Start/End: Original strand, 12700551 - 12700825
Alignment:
| Q |
37 |
ttcttcttcttcctcttgaacccatcaccttcccaacaaaacccccaagtactccatagtagctacatgtctacaaccccatatggatctgagaggagct |
136 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
12700551 |
ttcttcttcttcctcttgaacccatcaccttcccaacaaaacccccaagtactccatagtagctacaagtctacaaccccatatggatctgagaggagct |
12700650 |
T |
 |
| Q |
137 |
tcttccatattaaatatataggcgtgttcttgtgcgtggctaaggcgtgtt--------------tgaggctttgtggttctgtagccgcagagttgata |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
12700651 |
tcttccatattaaatatataggcgtgttcttgtgcgtagctaaggcgtgtttgaggcttgaggtatgaggctttgtggttctgtggccgcagagttgata |
12700750 |
T |
 |
| Q |
223 |
cggttggggggagttttttggcctaacattatgcctgttgttgctggttctgttttgctctctaggctttctagc |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12700751 |
tggttggggggagttttttggcctaacattatgcctgttgttgctggttctgttttgctctctaggctttctagc |
12700825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 22 - 85
Target Start/End: Complemental strand, 47615322 - 47615259
Alignment:
| Q |
22 |
ttccattccaatgatttcttcttcttcctcttgaacccatcaccttcccaacaaaacccccaag |
85 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47615322 |
ttccattccaatggtttcttcttcttcctcttgaacccatcaccttcccaacaaaacccccaag |
47615259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 189; Significance: 1e-102; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 37 - 297
Target Start/End: Original strand, 19753288 - 19753562
Alignment:
| Q |
37 |
ttcttcttcttcctcttgaacccatcaccttcccaacaaaacccc-caagtactccatagtagctacatgtctacaaccccatatggatctgagaggagc |
135 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
19753288 |
ttcttcttcttcctcttgaacc-atcaccttcccaacaaaaccccccaagtactccatagtagctacaagtctacaaccccatatggatctgagaggagc |
19753386 |
T |
 |
| Q |
136 |
ttcttccatattaaatatataggcgtgttcttgtgcgtggctaaggcgtgtt--------------tgaggctttgtggttctgtagccgcagagttgat |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
19753387 |
ttcttccatattaaatatataggcgtgttcttgtgcgtcgctaaggcgtgtttgaggcttgaggtatgaggctttgtggttctgtggccgcagagttgat |
19753486 |
T |
 |
| Q |
222 |
acggttggggggagttttttggcctaacattatgcctgttgttgctggttctgttttgctctctaggctttctagc |
297 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||| ||||||||| |
|
|
| T |
19753487 |
acggttggggggagttttttggcctaacactatgcctgttgttgctggttctgttttgctctttagactttctagc |
19753562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 22 - 85
Target Start/End: Complemental strand, 18486649 - 18486586
Alignment:
| Q |
22 |
ttccattccaatgatttcttcttcttcctcttgaacccatcaccttcccaacaaaacccccaag |
85 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18486649 |
ttccattccaatggtttcttcttcttcctcttgaacccatcaccttcccaacaaaacccccaag |
18486586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 114; Significance: 9e-58; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 114; E-Value: 9e-58
Query Start/End: Original strand, 152 - 297
Target Start/End: Complemental strand, 23169624 - 23169479
Alignment:
| Q |
152 |
atataggcgtgttcttgtgcgtggctaaggcgtgtttgaggctttgtggttctgtagccgcagagttgatacggttggggggagttttttggcctaacat |
251 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||| |||||||||||||||||| | |
|
|
| T |
23169624 |
atataggcgtgtacttgagcgtggctaaggcgtgtttgaggcttcgtggttctgtggccgcagagttgatacggttggagggagttttttggcctaatac |
23169525 |
T |
 |
| Q |
252 |
tatgcctgttgttgctggttctgttttgctctctaggctttctagc |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
23169524 |
tatgcctgttgttgctggttctgttttgctctctaggcattctagc |
23169479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 79; E-Value: 7e-37
Query Start/End: Original strand, 22 - 116
Target Start/End: Complemental strand, 23169720 - 23169626
Alignment:
| Q |
22 |
ttccattccaatgatttcttcttcttcctcttgaacccatcaccttcccaacaaaacccccaagtactccatagtagctacatgtctacaacccc |
116 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||| |
|
|
| T |
23169720 |
ttccattccaatggcttcttcttcttcctcttgaacccatcaccttcccaacaaaaccctcaagtactccatagtagctacaagtctacaacccc |
23169626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 37 - 85
Target Start/End: Complemental strand, 10007499 - 10007451
Alignment:
| Q |
37 |
ttcttcttcttcctcttgaacccatcaccttcccaacaaaacccccaag |
85 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10007499 |
ttcttcttcttcctcttgaacccatcaccttcccaacaaaacccccaag |
10007451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 60; Significance: 2e-25; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 22 - 85
Target Start/End: Original strand, 7500805 - 7500868
Alignment:
| Q |
22 |
ttccattccaatgatttcttcttcttcctcttgaacccatcaccttcccaacaaaacccccaag |
85 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7500805 |
ttccattccaatggtttcttcttcttcctcttgaacccatcaccttcccaacaaaacccccaag |
7500868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 218 - 296
Target Start/End: Original strand, 41740512 - 41740590
Alignment:
| Q |
218 |
tgatacggttggggggagttttttggcctaacattatgcctgttgttgctggttctgttttgctctctaggctttctag |
296 |
Q |
| |
|
||||||||||| ||| ||||||||||||||| ||||| |||||||||||||| ||||| | ||||||| |||||| |
|
|
| T |
41740512 |
tgatacggttgcgggattttttttggcctaacaggttgcctattgttgctggttctattttgatttctaggcattctag |
41740590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 51; Significance: 4e-20; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 23 - 85
Target Start/End: Complemental strand, 7316049 - 7315987
Alignment:
| Q |
23 |
tccattccaatgatttcttcttcttcctcttgaacccatcaccttcccaacaaaacccccaag |
85 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
7316049 |
tccattccaatggcttcttcttcttcctcttgaacccatcaccttcccaaaaaaacccccaag |
7315987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University