View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20072_low_27 (Length: 351)
Name: NF20072_low_27
Description: NF20072
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20072_low_27 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 312; Significance: 1e-176; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 312; E-Value: 1e-176
Query Start/End: Original strand, 1 - 332
Target Start/End: Original strand, 37066288 - 37066619
Alignment:
| Q |
1 |
atattggtatgtgaaaaaggagttaaaattggagactttggttgtgcaaagatgatcgatgaaattgtgccggctgccggaacaccgatgtatatggcgc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
37066288 |
atattggtatgtgaaaaaggagttaaaataggagactttggttgtgcaaagatgatcgatgaaattgcgccagctgccggaacaccgatgtatatggcgc |
37066387 |
T |
|
| Q |
101 |
cggaggtggcgcgcagcgaagaacaagggttcccttgtgatgtttggtcacttggttgcactattgttgaaatggcaactgggttttcaccttggtccaa |
200 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
37066388 |
cggaggtggcgcgcggcgaagaacaagggttcccttgtgatgtttggtcacttggttgcactattgttgaaatggcaactggtttttcaccttggtccaa |
37066487 |
T |
|
| Q |
201 |
tgtggaagactctgttcatgttctgtatcgtgttgcatattctgacgaagttcctatgattccttgttttttatctgaacaagcaaaggatttcttggag |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37066488 |
tgtggaagactctgttcatgttctgtatcgtgttgcatattctgacgaagttcctatgattccttgttttttatctgaacaagcaaaggatttcttggag |
37066587 |
T |
|
| Q |
301 |
aagtgcttaaggagggattctaaggagaggtg |
332 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
37066588 |
aagtgcttaaggagggattctaaggagaggtg |
37066619 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 118 - 191
Target Start/End: Complemental strand, 17501336 - 17501263
Alignment:
| Q |
118 |
gaagaacaagggttcccttgtgatgtttggtcacttggttgcactattgttgaaatggcaactgggttttcacc |
191 |
Q |
| |
|
|||||||||| ||| || ||||| |||||||||||||||||||||| |||||||||||||||| | |||||| |
|
|
| T |
17501336 |
gaagaacaagagttttctagtgatatttggtcacttggttgcactataattgaaatggcaactggttcttcacc |
17501263 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University