View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20072_low_28 (Length: 345)
Name: NF20072_low_28
Description: NF20072
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20072_low_28 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 180; Significance: 4e-97; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 180; E-Value: 4e-97
Query Start/End: Original strand, 14 - 193
Target Start/End: Complemental strand, 37495392 - 37495213
Alignment:
| Q |
14 |
tcctcctctctttccttttccccaggttttcttggaaaagaaaagcaaataaggtctggtcttttccaggtgctgtagccaacccagctttccactcttt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37495392 |
tcctcctctctttccttttccccaggttttcttggaaaagaaaagcaaataaggtctggtcttttccaggtgctgtagccaacccagctttccactcttt |
37495293 |
T |
 |
| Q |
114 |
cctttcccacttcttatgtttgtttcttcccctacctagctgaggttgaaataaaatgtttttactctaacttcagttgt |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37495292 |
cctttcccacttcttatgtttgtttcttcccctacctagctgaggttgaaataaaatgtttttactctaacttcagttgt |
37495213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 232 - 327
Target Start/End: Complemental strand, 37495174 - 37495079
Alignment:
| Q |
232 |
ctccacaagttgaaataaaacctagacgtacgggtcttggtgctgtattcaagtattatattagatttctttttgttcgttttccgccataaatat |
327 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
37495174 |
ctccacaagttgaaataaaacctagacgtacgggtcttggtgctgtattcaagtattatattagatttctttttgttcgttttccaccataaatat |
37495079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University