View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20072_low_31 (Length: 328)
Name: NF20072_low_31
Description: NF20072
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20072_low_31 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 291; Significance: 1e-163; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 291; E-Value: 1e-163
Query Start/End: Original strand, 1 - 319
Target Start/End: Complemental strand, 37495095 - 37494778
Alignment:
| Q |
1 |
ttttccaccataaatatatggtctagtttcaattagatcttatattattggttcaagataacttctagctatgctgcatatatattactatatcctaatc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37495095 |
ttttccaccataaatatatggtctagtttcaattagatcttatataattggttcaagataacttctagctatgctgcatatatattactatatcctaatc |
37494996 |
T |
 |
| Q |
101 |
tctttttgtttgactgctttactagcagtactataattttatacgtatacttggatattatttaataactttagaagaactttagtagatatggaagata |
200 |
Q |
| |
|
||||||| ||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37494995 |
tctttttttttgactgctt-actagtagtactataattttatacgtatacttggatattatttaataactttagaagaactttagtagatatggaagata |
37494897 |
T |
 |
| Q |
201 |
attaccacaagttgaatgtcccttttgtatgttttacagtgggtcatattgatggcaatattaacgtttattcttacactgctgctggattgcatctagg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37494896 |
attaccacaagttgaatgtcccttttgtatgttttacagtgggtcatattgatggcaacattaacgtttattcttacactgctgctggattgcatctagg |
37494797 |
T |
 |
| Q |
301 |
aggactcgtctgtgctgct |
319 |
Q |
| |
|
||||||||| ||||||||| |
|
|
| T |
37494796 |
aggactcgtgtgtgctgct |
37494778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University