View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20072_low_44 (Length: 244)
Name: NF20072_low_44
Description: NF20072
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20072_low_44 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 11769491 - 11769720
Alignment:
| Q |
1 |
tcaatttctgattccagtttcacctgcattgtttacttctactgtccgtttagttttctcttcttcacttccaatttctagatccgattttgcttttgtt |
100 |
Q |
| |
|
|||||||| |||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11769491 |
tcaatttccgattccggtttcacctgcattgtttacttctactgtccggttagttttctcttcttcacttccaatttctagatccgattttgcttttgtt |
11769590 |
T |
 |
| Q |
101 |
tcagcactttcgtcttcatgaatttgtttgcttaaaacctaatttc-tgttttgtttcgtttttatcaatttcgaaaattttgctgcttaattcgattat |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11769591 |
tcagcactttcgtcttcatgaatttgtttgcttaaaacctaatttcgatttttgtttcgtttttatcaatttcgaaaattttgctgcttaattcgattat |
11769690 |
T |
 |
| Q |
200 |
tcaatgatatgtgatagttgatagcgttgt |
229 |
Q |
| |
|
|||||||||||| ||||||||||||||||| |
|
|
| T |
11769691 |
tcaatgatatgtcatagttgatagcgttgt |
11769720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 50 - 84
Target Start/End: Original strand, 12706165 - 12706199
Alignment:
| Q |
50 |
ttagttttctcttcttcacttccaatttctagatc |
84 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| |
|
|
| T |
12706165 |
ttagttttctctacttcacttccaatttctagatc |
12706199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 152 - 229
Target Start/End: Original strand, 12706263 - 12706340
Alignment:
| Q |
152 |
tgtttcgtttttatcaatttcgaaaattttgctgcttaattcgattattcaatgatatgtgatagttgatagcgttgt |
229 |
Q |
| |
|
|||||||||||||| | || ||| |||| ||||| || ||||||||||| || |||||||||||||||||||||| |
|
|
| T |
12706263 |
tgtttcgtttttattgaatttgaaggtttttctgctgaaatcgattattcatagacatgtgatagttgatagcgttgt |
12706340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University