View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20072_low_46 (Length: 238)
Name: NF20072_low_46
Description: NF20072
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20072_low_46 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 116; Significance: 4e-59; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 16 - 222
Target Start/End: Original strand, 43486364 - 43486567
Alignment:
| Q |
16 |
aatatagggcataactaacagcatcatgctaacttaattaacactacttaaactatacatacacttttaagagtgattacacaagttccaaattatttat |
115 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
43486364 |
aatatagggcataactaaca------tgctaacttaattaacactacttaaactatacatacacttttaaaagtgattacacaagttccaaattatttat |
43486457 |
T |
 |
| Q |
116 |
atttgnnnnnnnaactagtgtctcatagacacttgttaacattttaggagattcaaagtatt---nnnnnnnntgtaagattataaaagtaattttaaaa |
212 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| ||||||||||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
43486458 |
atttgtttatttaactagtgtctcatagacacttgttaatattttaggagatttaaagtattaaaaaaaaaaatgtaagattataaaagtaattttaaaa |
43486557 |
T |
 |
| Q |
213 |
tccagggatg |
222 |
Q |
| |
|
|||||||||| |
|
|
| T |
43486558 |
tccagggatg |
43486567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University