View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20073_low_16 (Length: 259)
Name: NF20073_low_16
Description: NF20073
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20073_low_16 |
 |  |
|
| [»] scaffold0002 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0002 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 15 - 246
Target Start/End: Original strand, 337264 - 337495
Alignment:
| Q |
15 |
acattttactgaacaattttgttttccttgttgtcctatgaattggtaatgttaaattgtcaatcaaaggcacgatagtaaatgcattctcttctgtgca |
114 |
Q |
| |
|
|||||||||||||||| | |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
337264 |
acattttactgaacaaactagttttctttgttgtcctatgaattggtaatgttaaattgtcaatcaaaggcacgatagtaaatgcattctcttctgtgca |
337363 |
T |
 |
| Q |
115 |
catgtttagctacagagaactcgtagacgattggaactgcttctagaggattgtccatgtgaacttgatccttctgattactatgaaacaaccgaccagc |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
337364 |
catgtttagctacagagaactcgtagacgattggaactgcttctagaggattgtccatgtgaacttgatccttctgattactatgaaacaaccgaacagc |
337463 |
T |
 |
| Q |
215 |
ttttggaacctctgctcctctgttatgaatct |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
337464 |
ttttggaacctctgctcctctgttatgaatct |
337495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 136 - 246
Target Start/End: Original strand, 42173073 - 42173183
Alignment:
| Q |
136 |
cgtagacgattggaactgcttctagaggattgtccatgtgaacttgatccttctgattactatgaaacaaccgaccagcttttggaacctctgctcctct |
235 |
Q |
| |
|
|||||||| || ||||| ||||| |||||| | ||||||| |||||||| ||||| ||||||||| | |||||||||||||| |||||||||||| |
|
|
| T |
42173073 |
cgtagacggttagaacttcttcttgaggatgttgcatgtgactatgatcctttggattattatgaaacagctgaccagcttttggatcctctgctcctca |
42173172 |
T |
 |
| Q |
236 |
gttatgaatct |
246 |
Q |
| |
|
||||||||||| |
|
|
| T |
42173173 |
gttatgaatct |
42173183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University