View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20073_low_17 (Length: 255)

Name: NF20073_low_17
Description: NF20073
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20073_low_17
NF20073_low_17
[»] chr7 (1 HSPs)
chr7 (75-237)||(38931431-38931593)


Alignment Details
Target: chr7 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 75 - 237
Target Start/End: Complemental strand, 38931593 - 38931431
Alignment:
75 acaaaaactaaagagcattgtcaccatggtgaaaaagaaagaagccatggtgagagaacaagaaccagagaacatgaagaacaacacaacttcttcgatg 174  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
38931593 acaaaaactaaagagcattgtcaccatggtgaaaaagaaagaagccatggtgagagaacaagaaccagagaacatgaaggacaacacaacttcttcgatg 38931494  T
175 aaaccgtttgcacattgaagcttcatgagaacatagctgatccttcacgtgccgatgtgttta 237  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38931493 aaactgtttgcacattgaagcttcatgagaacatagctgatccttcacgtgccgatgtgttta 38931431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University