View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20073_low_17 (Length: 255)
Name: NF20073_low_17
Description: NF20073
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20073_low_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 75 - 237
Target Start/End: Complemental strand, 38931593 - 38931431
Alignment:
| Q |
75 |
acaaaaactaaagagcattgtcaccatggtgaaaaagaaagaagccatggtgagagaacaagaaccagagaacatgaagaacaacacaacttcttcgatg |
174 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
38931593 |
acaaaaactaaagagcattgtcaccatggtgaaaaagaaagaagccatggtgagagaacaagaaccagagaacatgaaggacaacacaacttcttcgatg |
38931494 |
T |
 |
| Q |
175 |
aaaccgtttgcacattgaagcttcatgagaacatagctgatccttcacgtgccgatgtgttta |
237 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38931493 |
aaactgtttgcacattgaagcttcatgagaacatagctgatccttcacgtgccgatgtgttta |
38931431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University