View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20074_high_29 (Length: 280)
Name: NF20074_high_29
Description: NF20074
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20074_high_29 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 21 - 269
Target Start/End: Complemental strand, 41634606 - 41634358
Alignment:
| Q |
21 |
gataatgttgaaattggttcattcaatgtattttgcactcaaacctaatgcaccccagaagtgtatttcaagaaaaattatatttcttaaactataacct |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41634606 |
gataatgttgaaattggttcattcaatgtattttgcactcaaacctaatgcaccccaaaagtgtatttcaagaaaaattatatttcttaaactataacct |
41634507 |
T |
 |
| Q |
121 |
aagtgaaattgaagaggttattgaaattaatcaaactggattcaatgataacaacataattccataaggcgtagtctttgaatatctttcatgaatatac |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41634506 |
aagtgaaattgaagaggttattgaaattaatcaaactagattcaatgacaacaccataattccataaggcgtagtctttgaatatctttcatgaatatac |
41634407 |
T |
 |
| Q |
221 |
attttatgttctgatgtctgggcatttccattgttcagttgtcaatatt |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41634406 |
gttttatgttctgatgtctgggcatttccattgttcagttgtcaatatt |
41634358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University