View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20074_high_30 (Length: 278)
Name: NF20074_high_30
Description: NF20074
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20074_high_30 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 123; Significance: 3e-63; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 14 - 148
Target Start/End: Original strand, 46661952 - 46662086
Alignment:
| Q |
14 |
cacagagtactgaaggagcactgtatgtgaaaaggaggggattgtttcctctcctttgtgataacttcattgttgtgagattcgtgctttctgaattgaa |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
46661952 |
cacagagtactgaaggagcactgtatgtgaaaaggaggggattgtgtcctctcctttgtgataacttaattgttgtgagattcgtgctttctgaattgaa |
46662051 |
T |
 |
| Q |
114 |
aaaatgtatccttcgttaacagagagtgttggagg |
148 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |
|
|
| T |
46662052 |
aaaatgtatccttcgttaacagacagtgttggagg |
46662086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 179 - 261
Target Start/End: Original strand, 46662114 - 46662196
Alignment:
| Q |
179 |
aggacccattttaattccgaagcgttttgtttggccttatggaggaacaagagtttatctcattggctctttcaccaggttct |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46662114 |
aggacccattttaattccgaagcgttttgtttggccttatggaggaacaagagtttatctcattggctctttcaccaggttct |
46662196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University