View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20074_high_35 (Length: 265)

Name: NF20074_high_35
Description: NF20074
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20074_high_35
NF20074_high_35
[»] chr8 (1 HSPs)
chr8 (1-217)||(12120186-12120402)


Alignment Details
Target: chr8 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 12120186 - 12120402
Alignment:
1 aaagagaatgtctcacggtggaatcccggcaggcggcagcgtttttgacagcagctatagcttcagggttttgattttattacttttttgcgtaacctcg 100  Q
    |||||||||||||||||||||||||||||||||| ||||||||||||  |||||||||||||||||||| ||||||||||||||||||||| ||||||||    
12120186 aaagagaatgtctcacggtggaatcccggcaggcagcagcgtttttggaagcagctatagcttcagggtgttgattttattacttttttgcctaacctcg 12120285  T
101 tgatatttaggtgcccaagctaatctgattgattttataacaatttttgaagat-nnnnnnnnntacttttaatacggtgaaaattgcatatggtgtcaa 199  Q
    ||||| || ||||||||||||||||| |||||||||||||||||||||||||||          ||||||||||||||||||||||||||||||||||||    
12120286 tgatactt-ggtgcccaagctaatctaattgattttataacaatttttgaagataaaaaaaaaatacttttaatacggtgaaaattgcatatggtgtcaa 12120384  T
200 tttatgtgttcaataata 217  Q
    ||||||||||||||||||    
12120385 tttatgtgttcaataata 12120402  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University