View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20074_high_35 (Length: 265)
Name: NF20074_high_35
Description: NF20074
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20074_high_35 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 12120186 - 12120402
Alignment:
| Q |
1 |
aaagagaatgtctcacggtggaatcccggcaggcggcagcgtttttgacagcagctatagcttcagggttttgattttattacttttttgcgtaacctcg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
12120186 |
aaagagaatgtctcacggtggaatcccggcaggcagcagcgtttttggaagcagctatagcttcagggtgttgattttattacttttttgcctaacctcg |
12120285 |
T |
 |
| Q |
101 |
tgatatttaggtgcccaagctaatctgattgattttataacaatttttgaagat-nnnnnnnnntacttttaatacggtgaaaattgcatatggtgtcaa |
199 |
Q |
| |
|
||||| || ||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
12120286 |
tgatactt-ggtgcccaagctaatctaattgattttataacaatttttgaagataaaaaaaaaatacttttaatacggtgaaaattgcatatggtgtcaa |
12120384 |
T |
 |
| Q |
200 |
tttatgtgttcaataata |
217 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
12120385 |
tttatgtgttcaataata |
12120402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University