View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20074_high_41 (Length: 236)
Name: NF20074_high_41
Description: NF20074
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20074_high_41 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 17 - 220
Target Start/End: Complemental strand, 38401608 - 38401405
Alignment:
| Q |
17 |
atactctagttttatagatggtactctcagcaactaagtacaaaactcctttttatcactatttggagtattaaag-tattttgaccacttggccaaaaa |
115 |
Q |
| |
|
|||||||||||| |||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
38401608 |
atactctagttt-atagattgtactctcagcaagtaagtacaaaactcctttttatcactatttggagtattaaaaatattttgaccacttgaccaaaaa |
38401510 |
T |
 |
| Q |
116 |
tatattttgaccataattttgaaaaatctagaaaaatcaatggttgtgatgcctgtgtcgacgtataccnnnnnnnnnattggtccacatgtgtgatgta |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| | |
|
|
| T |
38401509 |
tatattttgaccataattttgaaaaatctagaaaaatcaatggttgtgatgcctgtgtcgacgtatacactttttttaattggtccacatgtgtgatgga |
38401410 |
T |
 |
| Q |
216 |
gtgta |
220 |
Q |
| |
|
||||| |
|
|
| T |
38401409 |
gtgta |
38401405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University