View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20074_high_7 (Length: 487)
Name: NF20074_high_7
Description: NF20074
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20074_high_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 292; Significance: 1e-164; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 292; E-Value: 1e-164
Query Start/End: Original strand, 134 - 469
Target Start/End: Complemental strand, 30238675 - 30238337
Alignment:
| Q |
134 |
ctatgtaacacaataattgccaccttatgttttcataaatagtattttctaatgtattgaaggtatattgaagaagtcgatctcatgagatttttgaaga |
233 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30238675 |
ctatgtaacacagtaatttccaccttatgttttcataaatagtattttctaatgtattgaaggtatattgaagaagtcgatctcatgagatttttgaaga |
30238576 |
T |
 |
| Q |
234 |
gggttgagatacacaccatatttccactctttgaaggtgctcttgaaactgggaagattagcagatcttcctttagaaattgggtggtaagtcttgcttg |
333 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30238575 |
gggttgagatacacaccatatttccactctttgaaggtgcccttgaaactgggaagattagcagatcttcctttagaaattgggtggtaagtcttgcttg |
30238476 |
T |
 |
| Q |
334 |
aaaatttatcacttgtgaatatcaatttgtgtcac---nnnnnnnacaatagttatttatcaaattaattaatggtcattgaatttgtaatcagattcga |
430 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30238475 |
aaaatttatcacttgtgaatatcaatttgtgtcactttttttattacaatagttatttatcaaattaattaatggtcattgaatttgtaatcagattcga |
30238376 |
T |
 |
| Q |
431 |
gcttattatgaaagaaaagcactagcacaatcactgaat |
469 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30238375 |
gcttattatgaaagaaaagcactagcacaatcactgaat |
30238337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 71 - 133
Target Start/End: Complemental strand, 30238793 - 30238731
Alignment:
| Q |
71 |
gtaaggtcgcaaagggaaaaacatgattagttgtgtcttggtttcgtgaaacaatatcgatgt |
133 |
Q |
| |
|
|||||| |||||||| ||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
30238793 |
gtaagggcgcaaaggaaaaaacatgattagttgtgtcttggtttcgtaaaacaatatcgatgt |
30238731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University