View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20074_low_13 (Length: 402)
Name: NF20074_low_13
Description: NF20074
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20074_low_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 339; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 339; E-Value: 0
Query Start/End: Original strand, 18 - 381
Target Start/End: Complemental strand, 50530136 - 50529767
Alignment:
| Q |
18 |
tgttacactgagtttgcggttgatatgccggtcgccggtggcgcttttagctacctccgtgtcacattcggtgaatttgcggcctttataaccggtgcaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50530136 |
tgttacactgagtttgcggttgatatgccggtcgccggtggcgcttttagctacctccgtgtcacattcggtgaatttgcggcctttataaccggtgcaa |
50530037 |
T |
 |
| Q |
118 |
atctcatcatggattacgtgatgtcaaatgctgcagttgccagaggtttcaccaagtacgtcggcaccacagtcggtgtctcttctgctaaatggaggat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50530036 |
atctcatcatggattacgtgatgtcaaatgctgcagttgctagaggtttcaccaagtacgtcggcaccacagtcggtgtctcttctgctaaatggaggat |
50529937 |
T |
 |
| Q |
218 |
caccgttccttcttttccggaagggtttaaccaaatcgacttggttgctgtcgttgttgttttactcatcacagtggttatctgctacaggtttgtaact |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50529936 |
caccgttccttcttttccggaagggtttaaccaaatcgacttggttgctgtcgttgttgttttactcatcacagtggttatctgctacaggtttgtaact |
50529837 |
T |
 |
| Q |
318 |
gatccttcttgatcaacat------ccaccattaagcacagtcacagacaacaaacacgatatgatacac |
381 |
Q |
| |
|
||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50529836 |
gatccttcttgatcaacatccacatccaccactaagcacagtcacagacaacaaacacgatatgatacac |
50529767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University