View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20074_low_35 (Length: 271)
Name: NF20074_low_35
Description: NF20074
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20074_low_35 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 18 - 260
Target Start/End: Original strand, 28947105 - 28947349
Alignment:
| Q |
18 |
gattttacaaaactacagcttttgctaactattttataaaaacatgcactcaaaaacaaccctaaaatgcacttagcaagtcaaatacaagcaaaaaaga |
117 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
28947105 |
gattttacaaaactacagctttagctaactattttaaaaaaacatgcactcacaaacaaccctaaaatgcacttagcaagtcaaatagaagcaaaaaaga |
28947204 |
T |
|
| Q |
118 |
aagacatat--aaaggatgaaatgaaacctgtgatcttgggaagagaacgccagcttccatgaccaccattcttcttaatatagttagcaagaatttcat |
215 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28947205 |
aagacatatataaaggatgaaatgaaacctgtgatcttgggaagagaacgccagcttccatgaccaccattcttcttaatatagttagcaagaatttcat |
28947304 |
T |
|
| Q |
216 |
cctcttcagcagtccaaggtcctttcttcaaacccttcttctcac |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
28947305 |
cctcttcagcagtccaaggtcctttcttcaaacccttcttatcac |
28947349 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 52; Significance: 7e-21; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 155 - 246
Target Start/End: Complemental strand, 11745509 - 11745418
Alignment:
| Q |
155 |
ggaagagaacgccagcttccatgaccaccattcttcttaatatagttagcaagaatttcatcctcttcagcagtccaaggtcctttcttcaa |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| ||| | ||| |||||| |||||| |||||| ||||||||| ||||||||||| |
|
|
| T |
11745509 |
ggaagagaacgccagcttccatgaccaccatttttcttgataaaattaacaagaacttcatcttcttcactagtccaaggacctttcttcaa |
11745418 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University