View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20074_low_38 (Length: 252)
Name: NF20074_low_38
Description: NF20074
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20074_low_38 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 227; Significance: 1e-125; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 18 - 252
Target Start/End: Original strand, 11362602 - 11362836
Alignment:
| Q |
18 |
catcttcacagtgatttctcaagatattgacgccgacgatgtgaagaagcttctggatgcagggatctttacctgcaatagcttattgttacaagcaaag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11362602 |
catcttcacagtgatttctcaagatattgacgccgacgatgtgaagaagcttctggatgcagggatctttacctgcaatagcttattgttacaagcaaag |
11362701 |
T |
 |
| Q |
118 |
aaggtttagtttaactttaaacatgtctctgatttggatatctatagatgtggaattacttggcacttaaatagctttcataatgttgttattattgata |
217 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11362702 |
aaggtttagtttaactttaaacacgtctctgatttggatatctatagatgtggaattacttggcacttaaatagctttcataatgttgttattattgata |
11362801 |
T |
 |
| Q |
218 |
ttttctgtagaacttgactcgaatcaacggtctat |
252 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| |
|
|
| T |
11362802 |
ttttctgtagaacttgactcgaatcaacgatctat |
11362836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 20 - 101
Target Start/End: Original strand, 18554686 - 18554767
Alignment:
| Q |
20 |
tcttcacagtgatttctcaagatattgacgccgacgatgtgaagaagcttctggatgcagggatctttacctgcaatagctt |
101 |
Q |
| |
|
||||| ||||||||| ||||| ||| | |||| ||||| |||||||||| ||| ||||||||||||| ||||||| |||| |
|
|
| T |
18554686 |
tcttcgcagtgatttttcaaggaattaatgccggagatgtaaagaagcttcaggacgcagggatctttatctgcaatggctt |
18554767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 26 - 101
Target Start/End: Original strand, 46400719 - 46400794
Alignment:
| Q |
26 |
cagtgatttctcaagatattgacgccgacgatgtgaagaagcttctggatgcagggatctttacctgcaatagctt |
101 |
Q |
| |
|
||||||||||||||| ||| | |||| |||||||||||||||| ||| ||||||||||||||||||||| |||| |
|
|
| T |
46400719 |
cagtgatttctcaaggaattaatgccggagatgtgaagaagcttcaggacgcagggatctttacctgcaatggctt |
46400794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University