View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20076_high_1 (Length: 617)
Name: NF20076_high_1
Description: NF20076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20076_high_1 |
 |  |
|
| [»] scaffold0086 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 184; Significance: 3e-99; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 184; E-Value: 3e-99
Query Start/End: Original strand, 399 - 594
Target Start/End: Original strand, 5242328 - 5242523
Alignment:
| Q |
399 |
gaaatgagaaaatggccaaatataattgaagattaaaaagttaaaacacattgttatagcattacagaagatggagctatctttaaatttcttcttggag |
498 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5242328 |
gaaatgagaaaatggccaaatataattgaagattaaaaaattaaaacacattgttatagcatcacagaagatggagctatctttaaatttcttcttggag |
5242427 |
T |
 |
| Q |
499 |
ttttttgctgcaacataaaatacataaaaagaagatggtaaattgttatggaaagcaaaattgatggaaaattaaaacgtaagaagaaatgagagg |
594 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5242428 |
ttttttgctgcaacataaaatacaaaaaaagaagatggtaaattgttatggaaagcaaaattgatggaaaattaaaacgtaagaagaaatgagagg |
5242523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 117; E-Value: 3e-59
Query Start/End: Original strand, 134 - 263
Target Start/End: Original strand, 5188125 - 5188256
Alignment:
| Q |
134 |
gaatatcaactcagatcgaattaaaattacacgttggaagtaagcaagatgtgtaaagatatcatacctttcaaacagtgtttcaacattgcagtgtgcg |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5188125 |
gaatatcaactcagatcgaattaaaattacacgttggaagtaagcaagatgcgtaaagatatcatacctttcaaacagtgtttcaacattgcagtgtgcg |
5188224 |
T |
 |
| Q |
234 |
ttta--aggtaaatgaaacttcaagccttcaa |
263 |
Q |
| |
|
|||| |||||||||||||||||||||||||| |
|
|
| T |
5188225 |
tttaataggtaaatgaaacttcaagccttcaa |
5188256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 15 - 89
Target Start/End: Original strand, 5188006 - 5188080
Alignment:
| Q |
15 |
tcttcatttgctactaatattaacagtgttaacatatttctctatgttggaaaatgtgtgcggatcaaatgctac |
89 |
Q |
| |
|
||||||||||||||||||||| | |||||||||||||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
5188006 |
tcttcatttgctactaatattcatggtgttaacatatttgtctatgttggaaaatgtgtgcggatcaaatcctac |
5188080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0086 (Bit Score: 82; Significance: 2e-38; HSPs: 2)
Name: scaffold0086
Description:
Target: scaffold0086; HSP #1
Raw Score: 82; E-Value: 2e-38
Query Start/End: Original strand, 134 - 268
Target Start/End: Original strand, 47532 - 47668
Alignment:
| Q |
134 |
gaatatcaactcagatcgaattaaaattacacgttggaagtaagcaagatgtgtaaagatatcatacctttcaaaca--gtgtttcaacattgcagtgtg |
231 |
Q |
| |
|
||||||||||||| ||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||| | || ||||||| ||||||||| |
|
|
| T |
47532 |
gaatatcaactcatatcaaattaaaattacacgttggaagtaagtaagatgtgtaaagatatcatacctttcaaatattgtatttcaacgttgcagtgtt |
47631 |
T |
 |
| Q |
232 |
cgtttaaggtaaatgaaacttcaagccttcaaggtaa |
268 |
Q |
| |
|
| ||| |||||||||||||||||| ||||||||||| |
|
|
| T |
47632 |
catttggggtaaatgaaacttcaagtcttcaaggtaa |
47668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0086; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 309 - 353
Target Start/End: Original strand, 47735 - 47779
Alignment:
| Q |
309 |
ataatgaaaggaaattggtgcatatactattgactatcaatggtg |
353 |
Q |
| |
|
|||||||||| |||||| ||||||||||||||||||||||||||| |
|
|
| T |
47735 |
ataatgaaagcaaattgctgcatatactattgactatcaatggtg |
47779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 55; Significance: 3e-22; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 134 - 268
Target Start/End: Complemental strand, 25133493 - 25133359
Alignment:
| Q |
134 |
gaatatcaactcagatcgaattaaaattacacgttggaagtaagcaagatgtgtaaagatatcatacctttcaaacagtgtttcaacattgcagtgtgcg |
233 |
Q |
| |
|
||||||||||| ||||||||||||||| | |||||||||||| || ||||||||||| | | ||||||||||| | | |||||| ||| |||||| |
|
|
| T |
25133493 |
gaatatcaacttcaatcgaattaaaattagaggttggaagtaagtaacatgtgtaaagacagcctacctttcaaatattatttcaatgttgtagtgtgtc |
25133394 |
T |
 |
| Q |
234 |
tttaaggtaaatgaaacttcaagccttcaaggtaa |
268 |
Q |
| |
|
|||| ||||||||||||||||||||||||| |||| |
|
|
| T |
25133393 |
tttagggtaaatgaaacttcaagccttcaaagtaa |
25133359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 330 - 387
Target Start/End: Complemental strand, 25133194 - 25133137
Alignment:
| Q |
330 |
atatactattgactatcaatggtgaaggcatattagattataactgcaaatcaattga |
387 |
Q |
| |
|
|||||||||| ||||||||||||| | |||||||| ||||||| ||||||||||||| |
|
|
| T |
25133194 |
atatactattcactatcaatggtggaagcatattaacttataacggcaaatcaattga |
25133137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 270 - 318
Target Start/End: Complemental strand, 25133289 - 25133241
Alignment:
| Q |
270 |
attagtctaatttcataattgcctaagaatgaatgcagtataatgaaag |
318 |
Q |
| |
|
||||||||||||||||||| | ||| |||||||| ||||||||||||| |
|
|
| T |
25133289 |
attagtctaatttcataatcacttaaaaatgaatgtagtataatgaaag |
25133241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University