View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20076_high_26 (Length: 382)
Name: NF20076_high_26
Description: NF20076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20076_high_26 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 249; Significance: 1e-138; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 121 - 373
Target Start/End: Original strand, 5098941 - 5099193
Alignment:
| Q |
121 |
tctaaactgatgtgtgtccttttgtacaatctttttggcttcttattttatctcttatgtgaatgaatcaatattgccagttggcaattgtgtgcaaggg |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5098941 |
tctaaactgatgtgtgtccttttgtacaatctttttggcttcttattttatctcttatgtgaatgaatcaatattgccagttggcaattgtgtgcaaggg |
5099040 |
T |
 |
| Q |
221 |
tgtctgctagtgaaaatgagagaaaggatgtgataagagaaaaattatggaagccttgcattaccatcctatgctccttccaaaagatagtgatgtcctt |
320 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5099041 |
tgtctgctagtgaaaatgagagaaaggatgtgataagagaaaaattatggaagccttgcattaccatcctatgctccttccaaaagatagtgatgtcctt |
5099140 |
T |
 |
| Q |
321 |
ttttaggacaaaaagttaattttaagtttacctaagtcataataactgatgat |
373 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
5099141 |
ttttaggacaaaaagttaattttaagtttacctaagtcataataactaatgat |
5099193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 11 - 50
Target Start/End: Original strand, 5098822 - 5098861
Alignment:
| Q |
11 |
cataggggcgtagaagtcttattatatagtttttctcaac |
50 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
5098822 |
catagaggcgtagaagtcttattatatagtttttctcaac |
5098861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University