View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20076_high_27 (Length: 374)
Name: NF20076_high_27
Description: NF20076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20076_high_27 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 339; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 339; E-Value: 0
Query Start/End: Original strand, 16 - 358
Target Start/End: Complemental strand, 38575277 - 38574935
Alignment:
| Q |
16 |
atcaccgtgtcacaaaaatttcgccataacataaatacgaatttgctagagacacaaatgaatgagtatgtgatgtaatgtgatgactcataagtttcca |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38575277 |
atcaccgtgtcacaaaaatttcgccataacataaatacgaatttgcaagagacacaaatgaatgagtatgtgatgtaatgtgatgactcataagtttcca |
38575178 |
T |
|
| Q |
116 |
atattagagtgataattgaatgattgacctgatagaagtaaagtctacttgctaggccaccaacatcaagttcccaagtccttgcatcaccaacccaacc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38575177 |
atattagagtgataattgaatgattgacctgatagaagtaaagtctacttgctaggccaccaacatcaagttcccaagtccttgcatcaccaacccaacc |
38575078 |
T |
|
| Q |
216 |
atcacctttattaatgggataaccatactcaccccaaataggatgaggcaataactgaactatctcttgtgcttgaggattactataaggatcacaagta |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38575077 |
atcacctttattaatgggataaccatactcaccccaaataggatgaggcaataactgaactatctcttgtgcttgaggattactataaggatcacaagta |
38574978 |
T |
|
| Q |
316 |
ctaacaggttgctctaaatgttgagcattgcctggagcacagt |
358 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38574977 |
ctaacaggttgctctaaatgttgagcattgcctggagcacagt |
38574935 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University