View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20076_high_42 (Length: 321)
Name: NF20076_high_42
Description: NF20076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20076_high_42 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 8 - 191
Target Start/End: Original strand, 50781126 - 50781309
Alignment:
| Q |
8 |
agataattctcaagaacgacaatgatgtgagagtcgtgttctttatatttggacaatatagtttaaagggaccaattgagttagacgctttcttggccag |
107 |
Q |
| |
|
|||||| |||||||||| || |||||||||||||| ||||||||| ||||||||||||||||| ||||||| | ||||||||| |||||||||||||||| |
|
|
| T |
50781126 |
agataaatctcaagaacaacgatgatgtgagagtcatgttctttacatttggacaatatagttcaaagggatcgattgagttacacgctttcttggccag |
50781225 |
T |
|
| Q |
108 |
atcttttcattcagtaaagtttgattcggctcaggtcctatgacaaaatcaagtcttccatggataaactatatgaagaattca |
191 |
Q |
| |
|
||||||| ||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
50781226 |
atctttttattcaataaagtttgattcggcccaggtcctatgacaaaatcaagtcttccatggataaactataggaagaattca |
50781309 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 44 - 102
Target Start/End: Original strand, 55398889 - 55398947
Alignment:
| Q |
44 |
tgttctttatatttggacaatatagtttaaagggaccaattgagttagacgctttcttg |
102 |
Q |
| |
|
|||||||||||||||| || || ||||||||||||||||| ||| ||||| ||| |||| |
|
|
| T |
55398889 |
tgttctttatatttggtcagtacagtttaaagggaccaatcgagctagacacttccttg |
55398947 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University