View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20076_high_52 (Length: 293)
Name: NF20076_high_52
Description: NF20076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20076_high_52 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 61; Significance: 3e-26; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 14 - 107
Target Start/End: Complemental strand, 46347178 - 46347086
Alignment:
| Q |
14 |
tactaatatttatttggctatattaacaagtgtattaaagacattgtttaagaaacccatnnnnnnnnttatctaaaaaatataagtcaaacat |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
46347178 |
tactaatatttatttggctatattaacaagtgtcttaaagacattgtttaagaaacccat-aaaaaaattatctaaaaaatataagtcaaacat |
46347086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University