View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20076_high_62 (Length: 254)
Name: NF20076_high_62
Description: NF20076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20076_high_62 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 47501191 - 47500948
Alignment:
| Q |
1 |
cactctgggcttgcttcatcaggcaacaggtttgaaggtagctccatactcaaatatgttaccttgattgattaagtttaagagagattcatgcactata |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
47501191 |
cactctgggcttgcttcatcaggcaacaggtttgaaggtagctccatactcaaatatgttaccttaattgattaagtttaagagagattcatgcactata |
47501092 |
T |
 |
| Q |
101 |
taaataaatatgtgatcgattatgtttttacttggtagaggacatgcaatttgtcgtttctatttatttatt----tattgtatgggttctaaaggccgg |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
47501091 |
taaataaatatgtgatcgattatgtttttacttggtagaggacatgcaatttgtcgtttctatttatttatttatttattgtatgggttctaaaggccgg |
47500992 |
T |
 |
| Q |
197 |
ctaattcgttggcacttggct---gcaacagttaagtacgtttt |
237 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
47500991 |
ctaattcgttggcacttggctgcagcaacagttaagtacgtttt |
47500948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University