View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20076_high_72 (Length: 238)
Name: NF20076_high_72
Description: NF20076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20076_high_72 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 36487928 - 36487705
Alignment:
| Q |
1 |
aaaaatccccaaaataagatacaagctgtttacctttcatataaattcaatttcgattgcggtgttgaatttcaattaagctgttcagattgcaatgtac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36487928 |
aaaaatccccaaaataagatacaagctgtttacctttcatataaattcaatttcgattgcggtgttgaatttcaattaagctgttcagattgcaatgtac |
36487829 |
T |
|
| Q |
101 |
aatttttgttttccacatgaactccatttatttggcagcgatgttaagggataattcatatcaatttttgtttgttgattggcattagacaatcacggtt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
36487828 |
aatttttgttttccacatgaactccatttatttggcagcgatgttaagggataattcatatcaatttttgtttgttgaacggcattagacaatcacggtt |
36487729 |
T |
|
| Q |
201 |
gttgaactttcaatcattattatg |
224 |
Q |
| |
|
||||||||||||||||||| |||| |
|
|
| T |
36487728 |
gttgaactttcaatcattaatatg |
36487705 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 88; Significance: 2e-42; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 1 - 178
Target Start/End: Original strand, 3382680 - 3382854
Alignment:
| Q |
1 |
aaaaatccccaaaataagatacaagctgtttacctttcatataaattcaatttcgattgcggtgttgaatttcaattaagctgttcagattgcaatgtac |
100 |
Q |
| |
|
||||||||||||||||||||| | |||||| |||||||||| || ||||| ||||| ||||||||| ||||||||||||||| ||||||| ||| || |
|
|
| T |
3382680 |
aaaaatccccaaaataagataaa---tgtttaattttcatataagttgaattttgattgtggtgttgaacttcaattaagctgtttagattgcgatgcac |
3382776 |
T |
|
| Q |
101 |
aatttttgttttccacatgaactccatttatttggcagcgatgttaagggataattcatatcaatttttgtttgttga |
178 |
Q |
| |
|
| |||||||||||||| |||||||||||||||||| | | || ||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
3382777 |
actttttgttttccacgtgaactccatttatttggtaacaatattaagggataattcataccaatttttggttgttga |
3382854 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University