View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20076_high_82 (Length: 215)
Name: NF20076_high_82
Description: NF20076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20076_high_82 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 37 - 215
Target Start/End: Original strand, 44729612 - 44729790
Alignment:
| Q |
37 |
cagaagtgccaatataacataactaacaattaaaaccaacttaaaccaacaactttcactaatttgaccatattattgatcaaatctttgcaccaataaa |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44729612 |
cagaagtgccaatataacataactaacaattaaaaccaacttaaaccaacaactttcactaatttgaccatattattgatcaaatctttgcaccaataaa |
44729711 |
T |
|
| Q |
137 |
acttgtaaggaataaccaaccagatatctttctcttaaccttcttttccttaatggtatccaagctaggcttccaccct |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
44729712 |
acttgtaaggaataaccaaccagatatctttctcttaaccttcttttccttaattgtatccaagctaggcttccaccct |
44729790 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 177 - 215
Target Start/End: Complemental strand, 39084314 - 39084276
Alignment:
| Q |
177 |
ttcttttccttaatggtatccaagctaggcttccaccct |
215 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
39084314 |
ttcttctccttaatagtatccaagctaggcttccaccct |
39084276 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University