View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20076_high_86 (Length: 211)
Name: NF20076_high_86
Description: NF20076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20076_high_86 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 17 - 192
Target Start/End: Complemental strand, 26755737 - 26755562
Alignment:
| Q |
17 |
aagggcaggaaatttggctttcttgggttaatctttctcatttcctcaacatcttgcataggtctcttgttcatagttggccattgccacttattgcttg |
116 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26755737 |
aagggcaggaaatttggctttcttgggttgatctttctcatttcctcaacatcttgcataggtctcttgttcatagttggccattgccacttattgcttg |
26755638 |
T |
 |
| Q |
117 |
tgtttcgctcttcaccacctatgcagcttttagtctggaacatagtagcagcaacttgatcttcctccagtaatag |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
26755637 |
tgtttcgctcttcaccacctatgcagcttttagtctggaacatagtagcagcaaattgatcttcctccagtaatag |
26755562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University