View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20076_low_49 (Length: 314)
Name: NF20076_low_49
Description: NF20076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20076_low_49 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 216; Significance: 1e-118; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 3 - 246
Target Start/End: Complemental strand, 573200 - 572957
Alignment:
| Q |
3 |
ttttgatatatagtattatgtatccaattctccatcgattgttcataattataatacacttgcataatacacggtgtagcactaacattgtttagtgtct |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
573200 |
ttttgatatatagtattatgtatccaattctccatcgattgttcataattttaatacacttgcataatacacggtgtagcactaacattgtttagtgtcc |
573101 |
T |
 |
| Q |
103 |
caaaatattattagtgtcaacatgtctgcctgaatatcatgtccaatgtttgtgtcgggtgctgcttattcgtactttttgtgatgatacaaacatggag |
202 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||| |||||||| ||| |||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
573100 |
caaaatattattagtgtcaacatgtctgtctgaatatcatgttcaatgtttatgttgggtgctgcttattcgtactttttgtgatgatacaaacatagag |
573001 |
T |
 |
| Q |
203 |
taaattggtttatgttgttttaagtgcatgtttggttacttaag |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
573000 |
taaattggtttatgttgttttaagtgcatgtttggttacttaag |
572957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University