View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20076_low_53 (Length: 299)
Name: NF20076_low_53
Description: NF20076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20076_low_53 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 80 - 294
Target Start/End: Original strand, 304383 - 304597
Alignment:
| Q |
80 |
acaccatggacatttatgaaacacaaattgaatttctaaagcattgccaattgttggatattaatgggagaagtgtatgattgtgaagtgtatgatgctt |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
304383 |
acaccatggacatttatgaaacacaaattgaatttctaaagcattgccaattgttggatattaatgggagaagtgtatgattgtgaactgtatgatgctt |
304482 |
T |
 |
| Q |
180 |
tggctagtaaaatgttagccaactcagttgggtggaaagcatcccaaaacaaatatttcccacgatcttcacatacttgttgtaatggaagacaagtgat |
279 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
304483 |
tggctagtaaaatgttggccaactcagttgggtggaaagcatcccaaaacaaatatttcccacgatcttcacatacttgttgtaatggaagacaagtgat |
304582 |
T |
 |
| Q |
280 |
ttgtcctttgcttct |
294 |
Q |
| |
|
|||||| ||| |||| |
|
|
| T |
304583 |
ttgtccattgtttct |
304597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 18 - 79
Target Start/End: Original strand, 304309 - 304366
Alignment:
| Q |
18 |
attacaacagaatatcaacccatacatacgtggacaaaggaaatttaagaaacatgacaaca |
79 |
Q |
| |
|
||||||||||||||||||||||||| | |||||||||||||||||||||||||| |||| |
|
|
| T |
304309 |
attacaacagaatatcaacccatac----gcggacaaaggaaatttaagaaacatgaaaaca |
304366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University