View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20076_low_57 (Length: 283)
Name: NF20076_low_57
Description: NF20076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20076_low_57 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 17 - 272
Target Start/End: Complemental strand, 12624736 - 12624480
Alignment:
| Q |
17 |
actcaataatattgtttggatttggatggccaaactatacttggctatttgagtgtctagg-ttatagctgtattggttttgtagtgttttgagtggttg |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12624736 |
actcaataatattgtttggatttggatggccaaactatacttggctatttgagtgtctaggcttatagctgtattggttttgtagtgttttgagtggttg |
12624637 |
T |
 |
| Q |
116 |
gatatatggtaataagaatagaaatgattttacttattaagtatacaacctttgtggagatataaaggctaaatatggttgcttctactgacatatcaaa |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12624636 |
gatatatggtaataagaatagaaatgattttacttattaagtatacaacctttgtggagatataaaggctaaatatggttgcttctactgacatatcaaa |
12624537 |
T |
 |
| Q |
216 |
gcaccaataaacaaccaccatcttctgattttcacttagcttgttactattgccttt |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12624536 |
gcaccaataaacaaccaccatcttctgattttcacttagcttgttactattgccttt |
12624480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University